Custom DNA (left)Alpha DNA, toll-free fax for orders 1-800-511-3654Custom DNA (right)

Version française ici


Primers, probe and positive control for the Omicron variant of SARS-CoV-2 (Covid-19 virus), developed by the Joint Research Centre (JRC) of the European Commission ( :


Sequence (5 to 3); in green color : mutations specific to the Omicron

Size (number of bases)










Amplicon (positive control)




Here is a new reverse primer for the RNase P gene as a replacement for the faulty CDC RNase P reverse primer causing false positives and "contamination" problems in Covid-19 testing:  

Faulty CDC RNase P reverse primer: GAGCGGCTGTCTCCACAAGT

New correct primer from Rob Dekker and co-authors at the University of Amsterdam in the Netherlands:


We would like to strongly recommend to everyone replacing the faulty CDC primer with the above primer from the article of Rob Dekker et al. (link to the full-length article ).  The article also explains how and why exactly the CDC primer is faulty.  

NEW:  COVID-19 primers and probes used in different counties worldwide, according to the WHO (the World Health Organization)
Primer/probe name DNA sequence (5' to 3') recommended primer/probe final concentration (nM = nmol/liter) Alpha DNA (Alpha ADN) synthetic DNA primers and probes
catalog number synthesis scale guaranteed minimum DNA quantity (desalted oligonucleotides) Number of reactions per delivered product, 25 l PCR reaction volume) Price in USD
Primers and probes allowed by the CDC (Atlanta, Georgia) for use in the USA:
2019-nCoV_Nl-F  GACCCCAAAATCAGCGAAAT 500 nM U1 200 nmol 50 nmol /10 OD >4000 7.80
2019-nCoV_Nl-R  TCTGGTTACTGCCAGTTGAATCTG 500 nM U2 200 nmol 50 nmol /10 OD >4000 9.36
2019-nCoV_Nl-P  FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 125 nM U3 200 nmol 50 nmol /10 OD >16000 88.36
2019-nCoV_N2-F  TTACAAACATTGGCCGCAAA 500 nM U4 200 nmol 50 nmol /10 OD >4000 7.80
2019-nCoV_N2-R  GCGCGACATTCCGAAGAA 500 nM U5 200 nmol 50 nmol /10 OD >4000 7.02
2019-nCoV_N2-P  FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1 125 nM U6 200 nmol 50 nmol /10 OD >16000 87.97
2019-nCoV_N3-F  GGGAGCCTTGAATACACCAAAA 500 nM U7 200 nmol 50 nmol /10 OD >4000 8.58
2019-nCoV_N3-R  TGTAGCACGATTGCAGCATTG 500 nM U8 200 nmol 50 nmol /10 OD >4000 8.19
2019-nCoV_N3-P  FAM-AYCACATTGGCACCCGCAATCCTG-BHQ1 125 nM U9 200 nmol 50 nmol /10 OD >16000 88.36
RP-F RNAse P Forward AGATTTGGACCTGCGAGCG 500 nM U10 200 nmol 50 nmol /10 OD >4000 7.41
RP-R RNAse P Reverse

GAGCGGCTGTCTCCACAAGT (please avoid ordering

 this faulty CDC primer and replace it with the

 primer in the news alert above) RNase P



500 nM U11 200 nmol 50 nmol /10 OD >4000 7.80
RP-P RNAse P FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1 125 nM U12 200 nmol 50 nmol /10 OD >16000 87.97
Primers and probes used in mainland China (新型冠状病毒核酸检测引物和探针序列) :
Target 1ORF1ab:              
正向引物 ORF1ab(F): CCCTGTGGGTTTTACACTTAA 500 nM C1 200 nmol 50 nmol /10 OD >4000 8.19
反向引物 ORF1ab(R): ACGATTGTGCATCAGCTGA 500 nM C2 200 nmol 50 nmol /10 OD >4000 7.41
荧光探针 ORF1ab(P): FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 150 nM C3 200 nmol 50 nmol /10 OD >13333 89.92
Target 2N:              
正向引物 N(F): GGGGAACTTCTCCTGCTAGAAT 500 nM C4 200 nmol 50 nmol /10 OD >4000 8.58
反向引物 N(R): CAGACATTTTGCTCTCAAGCTG 500 nM C5 200 nmol 50 nmol /10 OD >4000 8.58
荧光探针 N(P): FAM-TTGCTGCTGCTTGACAGATT-BHQ1 150 nM C6 200 nmol 50 nmol /10 OD >13333 86.8
Primers and probes used in the Hong Kong Special Administrative Region of China:
Assay 1 (Target: ORF1b-nsp14)
HKU-ORF1b-nsp14F TGGGGYTTTACRGGTAACCT 500 nM H1 200 nmol 50 nmol /10 OD >4000 7.80
HKU- ORF1b-nsp14R AACRCGCTTAACAAAGCACTC 500 nM H2 200 nmol 50 nmol /10 OD >4000 8.19
(HKU-ORF1b-nsp141P FAM-TAGTTGTGATGCWATCATGACTAG-BHQ1 250 nM H3 200 nmol 50 nmol /10 OD >8000 88.36
Assay 2 (Target: N)              
HKU-NF TAATCAGACAAGGAACTGATTA 500 nM H4 200 nmol 50 nmol /10 OD >4000 8.58
HKU-NR CGAAGGTGTGACTTCCATG 500 nM H5 200 nmol 50 nmol /10 OD >4000 7.41
HKU-NP FAM-GCAAATTGTGCAATTTGCGG-BHQ1 250 nM H6 200 nmol 50 nmol /10 OD >8000 86.80
Primers and probes used in Japan:
1)      ORF1a set (regular PCR, not real-time PCR)
NIID_WH-1_F501 (S) TTCGGATGCTCGAACTGCACC 500 nM J1 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_R913 (AS)  CTTTACCAGCACGTGCTAGAAGG 500 nM J2 200 nmol 50 nmol /10 OD >4000 8.97
NIID_WH-1_F509 (S)  CTCGAACTGCACCTCATGG 500 nM J3 200 nmol 50 nmol /10 OD >4000 7.41
NIID_WH-1_R854 (AS)  CAGAAGTTGTTATCGACATAGC 500 nM J4 200 nmol 50 nmol /10 OD >4000 8.58
NIID_WH-1_Seq_F519 (S)  ACCTCATGGTCATGTTATGG 500 nM J5 200 nmol 50 nmol /10 OD >4000 7.80
NIID_WH-1_Seq_R840 (AS)  GACATAGCGAGTGTATGCC 500 nM J6 200 nmol 50 nmol /10 OD >4000 7.41
2)      S set (regular PCR, not real-time PCR)
WuhanCoV-spk1-f (S)  TTGGCAAAATTCAAGACTCACTTT 500 nM J7 200 nmol 50 nmol /10 OD >4000 9.36
WuhanCoV-spk2-r (AS)  TGTGGTTCATAAAAATTCCTTTGTG 500 nM J8 200 nmol 50 nmol /10 OD >4000 9.75
NIID_WH-1_F24381 (S)  TCAAGACTCACTTTCTTCCAC 500 nM J9 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_R24873 (AS)  ATTTGAAACAAAGACACCTTCAC 500 nM J10 200 nmol 50 nmol /10 OD >4000 8.97
NIID_WH-1_Seq_F24383 (S)  AAGACTCACTTTCTTCCACAG 500 nM J11 200 nmol 50 nmol /10 OD >4000 8.19
NIID_WH-1_Seq_R24865 (AS)  CAAAGACACCTTCACGAGG 500 nM J12 200 nmol 50 nmol /10 OD >4000 7.41
3)      Primers and probes for real-time RT-PCR
NIID_2019-nCOV_N_F2  AAATTTTGGGGACCAGGAAC 500 nM J13 200 nmol 50 nmol /10 OD >4000 7.80
NIID_2019-nCOV_N_R2  TGGCAGCTGTGTAGGTCAAC 700 nM J14 200 nmol 50 nmol /10 OD >2857 7.80
NIID_2019-nCOV_N_P2  FAM-ATGTCGCGCATTGGCATGGA-BHQ 200 nM J15 200 nmol 50 nmol /10 OD >10000 86.41
Primers and probes used in Germany:
Assay 1 (RdRRP)
RdRP_SARSr-F2  GTGARATGGTCATGTGTGGCGG 600 nM G1 200 nmol 50 nmol /10 OD >3333 8.58
RdRP_SARSr-R1  CARATGTTAAASACACTATTAGCATA 800 nM G2 200 nmol 50 nmol /10 OD >2500 10.14
RdRP_SARSr-P2  FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1 100 nM G3 200 nmol 50 nmol /10 OD >20000 88.75
(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)
RdRP_SARSr-P1  FAM-CCAGGTGGWACRTCATCMGGTGATGC-BHQ1 100 nM G4 200 nmol 50 nmol /10 OD >20000 89.14
(the above probe is a Pan-Sarbeco probe, will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs)
Assay 2 (E gene) (this set is identical to the one used in France, as is the final concentration of the primers and probes)
E_Sarbeco_F1  ACAGGTACGTTAATAGTTAATAGCGT 400 nM G5 200 nmol 50 nmol /10 OD >5000 10.14
E_Sarbeco_R2  ATATTGCAGCAGTACGCACACA 400 nM G6 200 nmol 50 nmol /10 OD >5000 8.58
E_Sarbeco_P1  FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 200 nM G7 200 nmol 50 nmol /10 OD >10000 89.14
Assay 3 (N gene), see
N_Sarbeco_F CACATTGGCACCCGCAATC 600 nM G8 200 nmol 50 nmol /10 OD >3333 7.41
N_Sarbeco_R GAGGAACGAGAAGAGGCTTG 800 nM G9 200 nmol 50 nmol /10 OD >2500 7.80
N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BHQ1 200 nM G10 200 nmol 50 nmol /10 OD >10000 88.75
Primers and probes used in Thailand:
WH-NIC N-F  CGTTTGGTGGACCCTCAGAT 1000 nM T1 200 nmol 50 nmol /10 OD >2000 7.80
(the above primer partially overlaps with the CDC probe 2019-nCoV_Nl-P)            
WH-NIC N-R  CCCCACTGCGTTCTCCATT 1000 nM T2 200 nmol 50 nmol /10 OD >2000 7.41
WH-NIC N-P  FAM-CAACTGGCAGTAACCA-BQH1 250 nM T3 200 nmol 50 nmol /10 OD >8000 85.24
Primers and probes used in France (Insitut Pasteur, Paris):
RdRp gene / nCoV_IP2
nCoV_IP2-12669Fw  ATGAGCTTAGTCCTGTTG 400 nM F1 200 nmol 50 nmol /10 OD >5000 7.02
nCoV_IP2-12759Rv  CTCCCTTTGTTGTGTTGT 400nM F2 200 nmol 50 nmol /10 OD >5000 7.02
nCoV_IP2-12696bProbe HEX-AGATGTCTTGTGCTGCCGGTA-BHQ1 160 nM F3 200 nmol 50 nmol /10 OD >12500 87.19
RdRp gene / nCoV_IP4
nCoV_IP4-14059Fw  GGTAACTGGTATGATTTCG 400 nM F4 200 nmol 50 nmol /10 OD >5000 7.41
nCoV_IP4-14146Rv  CTGGTCAAGGTTAATATAGG 400 nM F5 200 nmol 50 nmol /10 OD >5000 7.80
nCoV_IP4-14084Probe(+)  FAM-TCATACAAACCACGCCAGG-BHQ1 160 nM F6 200 nmol 50 nmol /10 OD >12500 86.41
E gene/E_Sarbeco (this set is identical to the one used in Germany, as is the final concentration of the primers and probes)
E_Sarbeco_F1  ACAGGTACGTTAATAGTTAATAGCGT 400 nM F7 200 nmol 50 nmol /10 OD >5000 10.14
E_Sarbeco_R2  ATATTGCAGCAGTACGCACACA 400 nM F8 200 nmol 50 nmol /10 OD >5000 8.58
E_Sarbeco_P1  FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 200 nM F9 200 nmol 50 nmol /10 OD >10000 89.14


To Alpha DNA Home PageTo Alpha DNA address, fax and E-mail contact infoTo Alpha DNA Products and PricesTo Alpha DNA Useful Info

© 1997-2024  Alpha DNA